Received Apr 30, 2025
| Type | Name | Manufacturer | Dose | Lot | Route / Site |
|---|---|---|---|---|---|
| COVID19 | COVID19 (COVID19 (MODERNA)) | MODERNA | UNK | — | — |
hypogammaglobulinemia; LIG1 deficiency that presented with macrocytic sideroblastic anemia; LIG1 deficiency that presented with macrocytic sideroblastic anemia; Patient developed SARS-CoV-2 infection 1 year after completing the primary series; This literature-non-study case was reported in a literature article and describes the occurrence of HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia) in a 37-year-old female patient who received SPIKEVAX NOS (SPIKEVAX NOS) for COVID-19 prophylaxis. The occurrence of additional non-serious events is detailed below. LITERATURE REFERENCE: The patient's past medical history included Lung infection (recurrent sinopulmonary infections as a child), Sinus infection (recurrent sinopulmonary infections as a child), Community acquired pneumonia (several hospitalizations), Seizure (several hospitalizations), Asthma (several hospitalizations for moderate-persistent asthma), Obstructive sleep apnea (several hospitalizations for mild obstructive sleep apnea) and Attention deficit hyperactivity disorder (several hospitalizations). Family history included Myelitis transverse (mother died at age 64 from complications related to transverse myelitis). Concurrent medical conditions included Macrocytic anemia (long-standing history of a mild underproduction macrocytic anemia). On an unknown date, the patient received dose of SPIKEVAX NOS (SPIKEVAX NOS) (unknown route) 1 dosage form. On an unknown date, after starting SPIKEVAX NOS (SPIKEVAX NOS), the patient experienced HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia) (seriousness criterion medically significant), SIDEROBLASTIC ANAEMIA (LIG1 deficiency that presented with macrocytic sideroblastic anemia), GENE MUTATION (LIG1 deficiency that presented with macrocytic sideroblastic anemia) and COVID-19 (Patient developed SARS-CoV-2 infection 1 year after completing the primary series). The patient was treated with Immunoglobulin human normal (Immunoglobulin) at an unspecified dose and frequency. At the time of the report, HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia), SIDEROBLASTIC ANAEMIA (LIG1 deficiency that presented with macrocytic sideroblastic anemia) and GENE MUTATION (LIG1 deficiency that presented with macrocytic sideroblastic anemia) outcome was unknown and COVID-19 (Patient developed SARS-CoV-2 infection 1 year after completing the primary series) had resolved. DIAGNOSTIC RESULTS (normal ranges are provided in parenthesis if available): On an unknown date, Aspiration bone marrow: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.. On an unknown date, Biopsy bone marrow: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.. On an unknown date, Blood folate: normal. On an unknown date, Electrophoresis: To confirm that the c.776+5G>T allele impacts splicing, reverse transcriptase polymerase chain reaction (RT-PCR) primers (LIG1_F: CAGGAGGAGGAAGAGCAGAC; LIG1_R: CAGGCATCTTCCACGGGAT) spanning the splice junction between exon 9 and 10 was performed. Agarose gel electrophoresis of RT-PCR amplicons showed a larger splicing product. Next-generation sequencing of this amplicon identified a 16-base pair insertion in transcripts derived from the c.776+5G>T allele (c.776ins16) predicted to result in a frameshift and termination present in 36% of the reads. It was unclear if this decreased transcript abundance was secondary to reduced efficiency of splicing at the normal splice donor site or nonsense-mediated decay of the aberrantly spliced mRNA. Whatever the mechanism, this finding supports\ed the notion that the c.776+5G>T allele was a genetic hypomorph.. On an unknown date, Flow cytometry: Flow cytometry on the marrow identified no abnormal myeloid, B, or T cell populations, and routine karyotype was 46, XX.. On an unknown date, Gene sequencing: (Negative) Clinical ALAS2 sequencing and In whole exome sequencing patient was found to have compound heterozygous LIG1 mutations (c.1922G>T, p.R641L and c.776+5G>T, NM_000234.3) that were confirmed to be in trans by PacBio long-range genomic sequencing.. On an unknown date, Haemoglobin: 11.6 gram per litre. On an unknown date, Immunophenotyping: Immunophenotyping showed mildly reduced CD19+ B cells, normal numbers of CD27+ memory B cells, and reduced immunoglobulin (Ig) class-switching with low IgM/IgD memory cells and virtual absence of IgA+ and IgG+ class switched memory B cells.. On an unknown date, Mean cell volume: 125 fL. On an unknown date, Natural killer cell count: Normal. On an unknown date, T-lymphocyte count: T cell was Normal. On an unknown date, Vitamin B12: Normal. For SPIKEVAX NOS (SPIKEVAX NOS) (Unknown), the reporter did not provide any causality assessments. Concomitant medications were not reported. The patient's full brother and 2 maternal half-sisters are healthy. Vaccination titers were protective for only 3 of 23 pneumococcal serotypes. T and NK cell numbers were normal, and response to mitogen stimulation with phytohemagglutinin and CD3 was normal. The patient was started on replacement immunoglobulin. She developed SARS-CoV-2 infection 1?year after completing the primary series of the mRNA-1273 vaccine and was successfully managed with antiviral therapy as an outpatient. This was first reported case of LIG1 deficiency diagnosed in an adult patient. Patient had mild clinical phenotypes. Patient harbored one missense variant that results in reduced LIG1 activity and a splice site variant, which may allow for some residual wild-type enzyme activity, accounting for the relatively mild clinical presentations. This report broadens the clinical spectrum of LIG1 deficiency and highlights the increasing awareness that inborn errors of immunity may manifest with a wide range of immunological features and varying degrees of disease severity. As the immune deficiency can be subtle, LIG1 deficiency should be considered in the differential diagnosis of patients presenting to hematologists with macrocytic sideroblastic anemia. Patient did not show evidence of excessive somatic heteroplasmic mitochondrial DNA variants, which argues against a major impact of LIG1 deficiency on mitochondrial DNA replication and repair.; Reporter's Comments: Long-standing history of macrocytic anemia remains as a confounder for sideroblastic anaemia. The benefit-risk relationship of product is not affected by this report.
Macrocytic anemia (long-standing history of a mild underproduction macrocytic anemia)
Medical History/Concurrent Conditions: Asthma (several hospitalizations for moderate-persistent asthma); Attention deficit hyperactivity disorder (several hospitalizations); Community acquired pneumonia (several hospitalizations); Lung infection (recurrent sinopulmonary infections as a child); Myelitis transverse (mother died at age 64 from complications related to transverse myelitis); Obstructive sleep apnea (several hospitalizations for mild obstructive sleep apnea); Seizure (several hospitalizations); Sinus infection (recurrent sinopulmonary infections as a child)
Test Name: Bone marrow aspirate; Result Unstructured Data: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.; Test Name: Bone marrow biopsy; Result Unstructured Data: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.; Test Name: folate level; Result Unstructured Data: normal; Test Name: Gel electrophoresis of RT-PCR; Result Unstructured Data: To confirm that the c.776+5G>T allele impacts splicing, reverse transcriptase polymerase chain reaction (RT-PCR) primers (LIG1_F: CAGGAGGAGGAAGAGCAGAC; LIG1_R: CAGGCATCTTCCACGGGAT) spanning the splice junction between exon 9 and 10 was performed. Agarose gel electrophoresis of RT-PCR amplicons showed a larger splicing product. Next-generation sequencing of this amplicon identified a 16-base pair insertion in transcripts derived from the c.776+5G>T allele (c.776ins16) predicted to result in a frameshift and termination present in 36% of the reads. It was unclear if this decreased transcript abundance was secondary to reduced efficiency of splicing at the normal splice donor site or nonsense-mediated decay of the aberrantly spliced mRNA. Whatever the mechanism, this finding supports\ed the notion that the c.776+5G>T allele was a genetic hypomorph.; Test Name: Flow cytometry; Result Unstructured Data: Flow cytometry on the marrow identified no abnormal myeloid, B, or T cell populations, and routine karyotype was 46, XX.; Test Name: Clinical ALAS2 sequencing; Test Result: Negative ; Test Name: whole exome sequencing; Result Unstructured Data: In whole exome sequencing patient was found to have compound heterozygous LIG1 mutations (c.1922G>T, p.R641L and c.776+5G>T, NM_000234.3) that were confirmed to be in trans by PacBio long-range genomic sequencing.; Test Name: hemoglobin; Test Name: Immunophenotyping; Result Unstructured Data: Immunophenotyping showed mildly reduced CD19+ B cells, normal numbers of CD27+ memory B cells, and reduced immunoglobulin (Ig) class-switching with low IgM/IgD memory cells and virtual absence of IgA+ and IgG+ class switched memory B cells.; Test Name: mean corpuscular volume [MCV]; Test Name: NK cell; Result Unstructured Data: Normal; Test Name: T cell; Result Unstructured Data: T cell was Normal; Test Name: vitamin B12; Result Unstructured Data: Normal